Solving Repeated DNA Sequences in go. Please try yourself first to solve the problem and submit your implementation to LeetCode before looking into solution.

Problem Description

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC", "CCCCCAAAAA"]

See the full details of the problem Repeated DNA Sequences at LeetCode

Originally posted at: @github.com/halfrost/LeetCode-Go